Skip to content

FETCH_GENOME Module

Overview

The FETCH_GENOME module downloads genome assembly sequences from NCBI in FASTA format using the GenBank Assembly (GCA) accession. It supports both direct file paths and automated downloads from NCBI's FTP server. Downloaded genomes are decompressed if necessary and made available for downstream quality assessment tools like BUSCO.

Module Location: pipelines/statistics/modules/fetch_genome.nf

Functionality

This module performs two key functions:

  1. Direct File Access: If meta.genome_file is provided, uses the specified file directly
  2. NCBI Download: If no file is provided, automatically downloads from NCBI using GCA accession

The module handles: - Genome download from NCBI FTP servers - Decompression of .gz files - File naming and organization - Checksum validation (when available)

Inputs

Channel Input

tuple val(meta)

Metadata Map:

[
    gca: String,                     // REQUIRED: GCA accession (e.g., "GCA_000001405.29")
    dbname: String,                  // Database name
    species_id: Integer,             // Species ID
    taxon_id: String,                // Taxonomy ID
    production_species: String,      // Production name (from DB_METADATA)
    busco_dataset: String,           // BUSCO dataset
    genome_file: String              // Optional: Direct path to genome file
]

Parameters

Parameter Type Default Description
params.outdir String ./results Base output directory
params.cacheDir String ./results/cache Directory for cached process outputs

Outputs

Channel Outputs

Channel Type Description
genome_file_output tuple val(meta), path("*.fna") Metadata + genome FASTA file
versions_file path("versions.yml") Software versions used

File Outputs

Genome FASTA File

Location: ${params.cacheDir}/${meta.gca}/ncbi_dataset/*.fna

Naming Convention: - NCBI/ENA downloads keep their source FASTA filename - Direct input files are copied as genome.fna

Format: Standard FASTA format

Content Example:

>CM000663.2 Homo sapiens chromosome 1, GRCh38.p14 Primary Assembly
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
...

File Size: Varies (50 MB - 10 GB typical range)

Versions File

Location: ${params.cacheDir}/${meta.gca}/ncbi_dataset/versions.yml

Format: YAML

Content Example:

"FETCH_GENOME":
    wget: 1.21.3
    gzip: 1.12

Process Configuration

Directives

label 'fetch_file'             // Use fetch_file resource allocation
tag "${meta.gca}"              // Tag with GCA accession
storeDir "${params.cacheDir}/${meta.gca}/ncbi_dataset"

Resource Allocation

From nextflow.config (fetch_file label):

  • CPUs: 2
  • Memory: 2 GB
  • Time: 4 hours
  • Queue: Standard

Container

ensemblorg/ensembl-genes-metadata:latest

Installed Tools: - wget - For downloading from NCBI FTP - gzip - For decompression - md5sum - For checksum validation

Implementation Details

NCBI FTP Structure

NCBI genomes are hosted at:

https://ftp.ncbi.nlm.nih.gov/genomes/all/

URL Pattern:

https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/{XXX}/{YYY}/{ZZZ}/GCA_XXXXXXXXX.Y_{assembly_name}/

Example:

# GCA_000001405.29 -> GCA/000/001/405/GCA_000001405.29_GRCh38.p14/
https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/001/405/GCA_000001405.29_GRCh38.p14/GCA_000001405.29_GRCh38.p14_genomic.fna.gz

Download Logic

The module uses a bash script to:

  1. Check for Direct File:

    if [ -n "${meta.genome_file}" ]; then
        # Use provided file
        cp -L ${meta.genome_file} genome.fna
    else
        # Download from NCBI
    fi
    

  2. Parse GCA Accession:

    GCA=${meta.gca}
    PREFIX1=${GCA:4:3}  # First 3 digits
    PREFIX2=${GCA:7:3}  # Next 3 digits  
    PREFIX3=${GCA:10:3} # Next 3 digits
    

  3. Construct NCBI URL:

    BASE_URL="https://ftp.ncbi.nlm.nih.gov/genomes/all"
    ASSEMBLY_URL="${BASE_URL}/GCA/${PREFIX1}/${PREFIX2}/${PREFIX3}/${GCA}_*"
    

  4. Download Genome:

    wget -r -np -nd -A "*_genomic.fna.gz" ${ASSEMBLY_URL}
    

  5. Decompress:

    if [ -f *.fna.gz ]; then
        gunzip *.fna.gz
    fi
    

Caching Strategy

The module uses storeDir to cache the downloaded *.fna and versions.yml under ${params.cacheDir}/${meta.gca}/ncbi_dataset/. When those outputs already exist, Nextflow can reuse them instead of running the download task body.

Nextflow -resume is still required for the standard work/ cache, but storeDir provides this module-level persistent cache across runs.

Cache Location: ${params.cacheDir}/GCA_XXXXXXXXX.Y/ncbi_dataset/

Usage Example

In a Workflow

include { FETCH_GENOME } from '../modules/fetch_genome.nf'

workflow {
    // Create input channel with GCA accession
    def input_ch = channel.of([
        gca: 'GCA_000001405.29',
        dbname: 'homo_sapiens_core_110_38',
        species_id: 1,
        taxon_id: '9606',
        production_species: 'homo_sapiens',
        busco_dataset: 'vertebrata_odb10',
        genome_file: ''  // Empty = download from NCBI
    ])

    // Fetch genome
    def genome_ch = FETCH_GENOME(input_ch).genome_file_output

    // Use genome file
    genome_ch.view { meta, fna_file ->
        "Downloaded genome for ${meta.production_species}: ${fna_file}"
    }
}

With Direct File Path

workflow {
    // Use pre-downloaded genome file
    def input_ch = channel.of([
        gca: 'GCA_000001405.29',
        dbname: 'homo_sapiens_core_110_38',
        species_id: 1,
        taxon_id: '9606',
        production_species: 'homo_sapiens',
        busco_dataset: 'vertebrata_odb10',
        genome_file: '/data/genomes/human_genome.fna.gz'
    ])

    FETCH_GENOME(input_ch)
}

Expected Output

Console Output:

Downloaded genome for homo_sapiens: /path/to/cache/GCA_000001405.29/GCA_000001405.29_GRCh38.p14_genomic.fna

Cached File: cache/GCA_000001405.29/GCA_000001405.29_GRCh38.p14_genomic.fna

File Size: ~3.1 GB (uncompressed)

Error Handling

Common Errors

1. Invalid GCA Accession

Error Message:

HTTP request sent, awaiting response... 404 Not Found

Cause: GCA accession doesn't exist on NCBI FTP server

Solution: - Verify GCA accession at NCBI Assembly - Check for typos in accession number - Ensure full accession with version (e.g., GCA_000001405.29, not GCA_000001405)

2. Network Timeout

Error Message:

failed: Connection timed out.
Retrying.

Solution: - Check internet connectivity - Increase timeout: wget --timeout=600 - Try alternative NCBI mirror - Consider using --genome_file parameter with pre-downloaded genome

3. Insufficient Disk Space

Error Message:

No space left on device

Solution: - Check available disk space: df -h - Clean cache directory: rm -rf cache/GCA_* - Use different cache location: --cacheDir /path/to/larger/disk

4. Corrupted Download

Error Message:

gzip: invalid compressed data--format violated

Solution:

# Remove corrupted file
rm cache/GCA_XXXXXXXXX.Y/*.fna.gz

# Re-run pipeline (will re-download)
nextflow run main.nf -resume

5. Missing Assembly on NCBI

Error Message:

No matches found for GCA_XXXXXXXXX.Y

Cause: Assembly removed or suppressed by NCBI

Solution: - Check assembly status at NCBI - Look for replacement assembly - Download genome manually and use --genome_file parameter

Version Tracking

The module captures software versions:

"FETCH_GENOME":
    wget: 1.21.3
    gzip: 1.12

Captured Versions: - wget version used for download - gzip version used for decompression

Integration with Other Modules

Upstream Modules

  1. DB_METADATA: Provides gca accession and production name
  2. BUSCO_DATASET: Provides BUSCO dataset information

Downstream Modules

  1. BUSCO_GENOME_LINEAGE: Uses genome file for BUSCO assessment

Data Flow Diagram

graph LR
    A[DB_METADATA] --> B[BUSCO_DATASET]
    B --> C[FETCH_GENOME]
    C --> D[BUSCO_GENOME_LINEAGE]

    style C fill:#90EE90

Best Practices

1. Use Shared Cache

For multi-user environments, use a shared cache:

# Create shared cache directory
mkdir -p /shared/data/genome_cache
chmod 775 /shared/data/genome_cache

# Configure pipeline
nextflow run main.nf \
    --cacheDir /shared/data/genome_cache

2. Pre-download Large Genomes

For large genomes (>5 GB), pre-download to avoid timeouts:

# Download manually
wget https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/XXX/YYY/ZZZ/GCA_*_genomic.fna.gz

# Use in pipeline
nextflow run main.nf \
    --genome_file /data/genomes/large_genome.fna.gz

3. Monitor Disk Usage

Genomes can consume significant disk space:

# Check cache size
du -sh cache/

# List largest genomes
du -h cache/GCA_* | sort -h | tail -10

# Clean old genomes (older than 30 days)
find cache/ -name "*.fna" -mtime +30 -delete

4. Validate Downloaded Genomes

Verify genome integrity after download:

# Check FASTA format
head -n 1 cache/GCA_000001405.29/*.fna
# Should start with '>'

# Count sequences
grep -c "^>" cache/GCA_000001405.29/*.fna

# Check file size
ls -lh cache/GCA_000001405.29/*.fna

Performance Considerations

Download Times

Typical download times (100 Mbps connection):

Genome Size Compressed Uncompressed Download Time Decompression
Small (10 MB) 3 MB 10 MB 10 seconds 5 seconds
Medium (100 MB) 30 MB 100 MB 1 minute 30 seconds
Large (1 GB) 300 MB 1 GB 5 minutes 3 minutes
Very Large (10 GB) 3 GB 10 GB 30 minutes 20 minutes

Parallelization

Multiple genomes can be downloaded in parallel:

// Download 10 genomes simultaneously
channel.fromPath('genomes.csv')
    .splitCsv(header: true)
    .map { row -> [gca: row.gca, /*...*/] }
    | FETCH_GENOME  // Downloads in parallel

Recommended concurrency: 5-10 simultaneous downloads

Network consideration: Limit concurrent downloads to avoid overwhelming NCBI servers

Caching Benefits

With storeDir caching:

  • First run: Full download time (minutes to hours)
  • Subsequent runs: Reuses the stored .fna from the store directory without downloading again
  • Cache hit rate: Typically >80% for repeated analyses

Resource Usage

During download: - CPU: <10% (wget is I/O bound) - Memory: <100 MB - Disk I/O: Write speed limited by network - Network: Full available bandwidth

During decompression: - CPU: 100% (single-threaded gzip) - Memory: <500 MB - Disk I/O: Heavy write activity

Advanced Features

Custom NCBI Mirror

Use alternative NCBI mirror for faster downloads:

script:
"""
# Use European mirror
NCBI_MIRROR="ftp.ebi.ac.uk/pub/databases/genbank"

wget \${NCBI_MIRROR}/genomes/all/GCA/...
"""

Checksum Validation

Add MD5 checksum validation:

script:
"""
# Download genome and checksum
wget ${ASSEMBLY_URL}/*_genomic.fna.gz
wget ${ASSEMBLY_URL}/md5checksums.txt

# Validate
md5sum -c md5checksums.txt
"""

Compressed Output

Keep genome compressed to save disk space:

output:
path("*.fna.gz"), emit: genome_file_output

script:
"""
# Skip decompression step
wget ${ASSEMBLY_URL}/*_genomic.fna.gz
# Don't gunzip - use compressed file
"""

Note: Downstream tools must support .gz input

Testing

Unit Test

Test genome download for a small genome:

# Test with E. coli genome (small, fast download)
nextflow run pipelines/statistics/main.nf \
    --run_busco_ncbi \
    --csvFile test_data/test_fetch_genome.csv \
    --cacheDir ./test_cache \
    --outdir ./test_results \
    --max_cpus 2 \
    -entry BUSCO \
    -process.executor 'local'

test_fetch_genome.csv:

gca,taxon_id,species_id,busco_dataset,genome_file,protein_file
GCA_000005845.2,511145,1,bacteria_odb10,,

Expected Test Result

File: test_cache/GCA_000005845.2/GCA_000005845.2_ASM584v2_genomic.fna

File Size: ~4.6 MB

Sequences: ~400 (chromosome + plasmids + scaffolds)

Validation

Verify genome download:

# Check file exists
ls -lh test_cache/GCA_000005845.2/*.fna

# Count sequences
grep -c "^>" test_cache/GCA_000005845.2/*.fna

# Check sequence headers
grep "^>" test_cache/GCA_000005845.2/*.fna | head -5

Expected headers:

>U00096.3 Escherichia coli str. K-12 substr. MG1655, complete genome

Troubleshooting

Debug Mode

Enable verbose wget output:

script:
"""
wget -v -r -np -nd -A "*_genomic.fna.gz" ${ASSEMBLY_URL}
"""

Check NCBI FTP Availability

Test NCBI FTP access:

# Test connection
curl -I https://ftp.ncbi.nlm.nih.gov/genomes/

# List available assemblies for a GCA
curl -s https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/001/405/ | grep "GCA_000001405"

Manual Download

Download genome manually for troubleshooting:

# Find assembly directory
GCA="GCA_000001405.29"
curl -s https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/001/405/ | grep ${GCA}

# Download genome
wget https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/001/405/GCA_000001405.29_GRCh38.p14/GCA_000001405.29_GRCh38.p14_genomic.fna.gz

# Decompress
gunzip GCA_000001405.29_GRCh38.p14_genomic.fna.gz

# Use in pipeline
nextflow run main.nf --genome_file $(pwd)/GCA_000001405.29_GRCh38.p14_genomic.fna

References


Last Updated: 2026-02-06
Module Version: 1.0.0
Maintained By: Ensembl Genes Team